2013 Publications

  1. Kothekar, D., K., Dasgupta D. (2013).  Evaluation of in vitro conditions influencing phosphotidylinositol-specific phospholipase C production by Staphylococcus aureus ATTCC 9144. International Journal of Pharma and Bio Sciences, 4(1),(B) 59-69.

  2. Jha, P., Jobby, R., Kudale, S., Modi, N., Dhaneshwar, A., & Desai, N. (2013). Biodegradation of phenol using hairy roots of Helianthus annuus L. International Biodeterioration & Biodegradation, 77, 106-113.

  3. Anerao, S., Desai, N., & Deodhar, M. (2013). Karyomorphology of Garcinia Indica (Thomas-Dupettite) Choisy, Journal of Tropical Agriculture, 51(1-2), 140-143.

  4. Deodhar, M., & Desai, N. (2013). A Comparative Study of Karyomorphology Among three Populations of Garcinia indica (Clusiaceae). Pakistan J. Of Biological Sciences, 16(11), 530-535.

  5. Bandre, A., & Deasi N. (2013). Omega3: An Effective Nutritional Dietary Supplement. D Y Patil J of Health Sciences, 1(1), 16-18.

  6. Singh, N., Luthra, D., & Desai, N. (2011). Evaluation of Vitamin B12 Synthesis by isolated Rhizobium sp. from Sesbania sesban found in Mumbai and its suburban areas. IJAR, 3(7), 68-72.

  7. Singh, N., Luthra, D., & Desai, N. (2011). Phenotypic and Genotypic Characterization of Rhizobium species isolated from the root nodules of Sesbania sesban found in Mumbai and its suburban areas. IJAR, 3(7), 60-67.

  8. Lokhande, V., Gor, B., Desai, N., Nikam, T., & Suprasanna, P. (2012). Sesuvium portulacastrum, a plant for drought, salt stress, sand fixation, food and phytoremediation. A review. Agronomy For Sustainable Development, 33(2), 329-348.

  9. Ghatak, A., Chaturvedi, P., & Desai, N. (2013). Indian Grape Wines: A Potential Source of Phenols, Polyphenols, and Antioxidants. International Journal Of Food Properties, 17(4), 818-828.

  10. Pai, T., Sawant, S., Ghatak, A., Chaturvedi, P., Gupte, A., & Desai, N. (2013). Characterization of Indian beers: chemical composition and antioxidant potential. J Food Sci Technol, 52(3), 1414-1423.

  11. Garg, D., Ayesha, S., Nishtha, K., & Thankamani M. (2013). Comparative evaluation of various total antioxidant capacity assays applied to phytochemical compounds of Indian culinary spices, International Food Research Journal, 20(4), 1711-1716.

  12. Singh, K., Mhatre, V., Bhori, M., & Marar, T. (2013). Vitamins E and C reduce oxidative stress and mitochondrial permeability transition caused by camptothecin – an in vitro study. Toxicological & Environmental Chemistry, 95(4), 646-657.

  13. Parvathi, J., R., & Sunita, S. (2013). Epigenetic and Non-epigenetic Switch Mechanisms in Escherichia coli, Journal of Pure and Applied Microbiology, 7 (1), 533-541.

  14. Parvathi, J., R., & Sunita, S. (2013). Probe|31781046|PRIMERF Forward PCR primer (outermost) 23SP2_F_682 (20b): CCGACCTGCACGAATGGCGT  and Probe|31781046|PRIMERR Reverse PCR primer (outermost) 23SP2_R_682 (20b): CAGTTCTCCAGCGCCCACGG, Genebank.

  15. Parvathi, J., R., & Sunita, S. (2013). Probe|31778738|PRIMERF Forward PCR primer (outermost) 23SP1_880 (20b)GGCGAAAAGAACCCCGGCGA and Probe|31778738|PRIMERR Reverse PCR primer (outermost) 23SP1 RP (20b): AGGGGTCGACTCACCCTGCC, Genebank.

  16. Parvathi, J., R., & Sunita, S. (2013). Escherichia coli strain ATCC 15223 23S ribosomal RNA gene, partial sequence , GenBank: JX869172.1.

  17. Parvathi, J., R., & Sunita, S. (2013). Citrobacter freundii ATCC 8090 = MTCC 1658 23S ribosomal RNA gene, partial sequence. Broad range PCR analysis of 23S rrn,  GenBank: JX869173.1.

  18. Parvathi, J., R., & Sunita, S. (2013). Citrobacter koseri strain ATCC 27028 23S ribosomal RNA gene, partial sequence, , Broad range PCR analysis of 23S rrn, GenBank: JX869174.1.

  19. Parvathi, J., R., & Sunita, S. (2013).  Klebsiella pneumoniae strain ATCC 33495 23S ribosomal RNA gene, partial sequence,   Broad range PCR analysis of 23S rrn, GenBank: JX869175.1.

  20. Parvathi, J., R., & Sunita, S. (2013). Enterobacter aerogenes strain ATCC 13048 23S ribosomal RNA gene, partial sequence, Broad range PCR analysis of 23S, GenBank: JX869176.1.

  21. Parvathi, J., R., & Sunita, S. (2013). Escherichia coli strain ATCC 15223 23S ribosomal RNA gene, partial sequence, Barcoding and Genetic diversity in microbes.  GenBank: KF034790.1

  22. Parvathi, J., R., & Sunita, S. (2013). Escherichia coli strain ATCC 25922 23S ribosomal RNA gene, partial sequence, GenBank: KF034791.1

  23. Parvathi, J., R., & Sunita, S. (2013). Pitfalls of bacterial identification methods, International Journal of Chemical, Ecological and Biological Sciences, 1(1), 169-172.

  24. Parvathi, J., R., & Sunita, S. (2013). Escherichia coli DSM 30083 = JCM 1649 strain ATCC 11775 23S ribosomal RNA gene, partial sequence, Barcoding and Genetic diversity in microbes, GenBank: KF034792.1,

  25. Bhat, M., & Shewade, L. (2013). Isolation and characterization of microorganisms from mangrove soil of CBD Belapur, Navi Mumbai , MS India, International Journal of Environmental Sciences, 3(5), 2304-2312.

  26. Mittal, A., Thakur, V., & Gajbe, V. (2012). Adsorptive removal of toxic azo dye Amido Black 10B by hen feather. Environmental Science And Pollution Research, 20(1), 260-269.

  27. Patki, J., & Pawar, S. (2013). HSP90: Chaperone-me-not. Pathology & Oncology Research, 19(4), 631-640.

  28. Yadav, R., &  Mhatre, B. (2013).  Effect of Diesel Hydrocarbon on growth and Degradation of diesel by Algae Ectocarpus Sp, Pollution Research, 32(3), 583-587.

  29. Kaul, A., &  Mhatre, B. (2013). Isolation of Diesel degrading microorganisms from mangroves of Navi Mumbai region,  Journal of Ecobiology, 32(2), 105-111.

  30. Kamble, R., & Gupte,  A. (2013). Isolation and screening of cyclodextrinase producer from soil, GenBank, Accession Number : KF415293.

  31. Gupte, A., & Nair, J. (2013). Biosorption of copper by the yeast Kluyveromyces marxianus grown on whey, D Y Patil Journal of Health Sciences, 1(1), 35-38.

  32. Vidhate, D., Thomas, J., & Gupte, A. (2013). Association of IL-6 with Diabetes Mellitus in Indian population from Navi Mumbai., International Journal of Recent Trends in Science and Technology, 8(2), 100-102.

  33. Vidhate, D., Thomas, J., & Gupte, A. (2013). IL-6, an important mediator of obesity based inflammation, International Journal of Advanced and Innovative Research, 2, 283-286.

  34. Padte, S., Rokade, K., Mali, G., & Kudale, S. (2013). Biodegradation of sulfonated aromatic amines by Pseudomonas desmolyticum NCIM 2112, Journal of Chemical and Pharmaceutical Research, 5(4), 335-339.

  35. Joshi, N., Jain, A., & Arya, K. (2011). Alleviation of Salt Stress in Cucumis Sativus L. Through Seed Priming with Calcium Chloride. IJAR, 3(11), 22-25.

  36. Nagare, S. (2013). Homology modeling of GPCR kinase and its role in genetic oriented Hypertension, International Journal of Multidiciplinary Research, 1(ii), 49-51.

  37. Waghu, F., Gopi, L., Barai, R., Ramteke, P., Nizami, B., & Idicula-Thomas, S. (2013). CAMP: Collection of sequences and structures of antimicrobial peptides. Nucleic Acids Research, 42(D1), D1154-D1158. http://dx.doi.org/10.1093/nar/gkt1157

  38. Kumar C, S., & M.M. Mohammed, S. (2013). An In silico Based Comparison of Drug Interactions in Wild and Mutant Human β-tubulin through Docking Studies, Research Journal of Biotechnology, 8 (8), 20-29.

  39. Kumar C, S., Gadewal, N., & M.M. Mohammed, S. (2013). Identification of Leads from Marine Seaweeds against Human β-tubulin. Letters In Drug Design & Discovery, 10(1), 67-74. http://dx.doi.org/10.2174/157018013804142401

  40. Padwal, P., & Kulkarni, S. (2013). Surface Morphology of Polyaniline Thin Films Prepared by RF Plasma Polymerization, International Journal of Physics and Research, 3(1), 29-32.

  41. Padwal, P., & Kulkarni, S. (2013). Preparation of Aluminium Oxide Film by Anodic Oxidation and Effect of Plasma Etching on Its Surface, International Journal of Applied Engineering and Technology, 3 (1), 69-72.

  42. Padwal, P., Kulkarni, S., & Patil, A. (2013). Comparative and Morphological Study of Anodized Aluminium Oxide Thin Films Formed at Different Current Densities, International Journal of Physics and Mathematical Sciences, 3 (2),  21-24.

  43. Padwal, P., Kulkarni, S., & Patil, A. (2013). Modification and Morphological Study of Plasma Etched Aluminium Oxide Thin Film, International Journal of Physics and Mathematical Sciences, 3 (2),  25-28.

  44. P.Padwal, P. (2013). Study of Electrical Properties of Polyaniline Films Prepared By Rf Plasma Polymerization. IOSR Journal Of Applied Physics, 3(3), 59-61. http://dx.doi.org/10.9790/4861-0335961

  45. Tagore, S., & De, R. (2013). Simulating an Infection Growth Model in Certain Healthy Metabolic Pathways of Homo sapiens for Highlighting Their Role in Type I Diabetes mellitus Using Fire-Spread Strategy, Feedbacks and Sensitivities. Plos ONE, 8(9), e69724. http://dx.doi.org/10.1371/journal.pone.0069724

  46. Tagore, S., & Vijayaraghavan, T. (2013). Carnitine translocase in cardiac cell: structural, functional and flux balance analysis in pre-β-oxidation pathway of Homo sapiens, International Journal of Systems, Algorithms & Applications, 3(2), 26-29.

  47. Tagore, S., & Chatterjee, A. (2013). Implementing Cellular Neural Networks to Identify Abnormalities in Brain MRI Images, IJAINN, 3 (ICRASE13), 60-63.

  48. Tagore, S., Chatterjee, A. (2013). Using Run Length Encoding in Cellular Neural Networks for detecting abnormalities in biomedical images in real time, In Proceedings: IEEE – 2nd Students’ Conference on Engineering and Systems (SCES 2013), 171-174.

  49. Sharma, N., Gupta,V., Shetty, V. & Ranjan, A. (2013). VARYSTIM, International Journal of Computer Applications, 1, 1-3.

  50. Gupta, P.,  Nanavaty, V., & Shah, P. (2013). Homology Modeling of MTNR1B and Insilico Structure Activity Relationship study of Melatonin analogs for therapeutic application in Insomnia and Insomnia related diabetes, Int Journal of Pharma and  Biological Sciences, B 4(1),  494 – 506.

  51. Parvathi, J., R., & Gokhale, M. (2013). Collation of data for barcoding and restriction profiling of ribosomal segments of bacterial genome, Copyright L-55194/2013,

  52. Bhat, M., Nair, J., & Marar, T. (2013). Extracellur L-asparaginase from Salinicoccus species, Bionano Frontier, 6(3), 137-139  .

  53. Kamble, R., & Gupte, A. (2013). Antimicrobial, Anticholesterol and Antioxidant activity studies of Ganoderma lucium mycelia, Proceedings of “Prospects and Challenges in Biotechnology and Printing & Packaging Industry”.

  54. Kamble, R., & Gupte, A. (2013). NCBI (Bacterial Sequence  – B. oshimensis), GenBank.